View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_281 (Length: 252)
Name: NF10829A_low_281
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_281 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 3642399 - 3642159
Alignment:
| Q |
8 |
tgaaatgaagctgctaactttatgatcgtctcaagattcatttgttgtctcaaattttaaagtattgactgccagagaagtttcaacaaggaaaatcgga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3642399 |
tgaaatgaagctgctaactttatgatcgtctcaagattcatttgttgtctcaaattttaaagtattgactgccggagaagtttcaacaaggaaaatcgga |
3642300 |
T |
 |
| Q |
108 |
accattgtctagtgtagcatttgttcatctaatttcagctgccttggttagtttattcgcatcaatatcctggtcatgttaactttggcactgatgatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3642299 |
accattgtctagtgtagcatttgttcatctaatttcagctgccttggttagtttattcgcatcaatatcctggtcatgttaactttggcactgatgatat |
3642200 |
T |
 |
| Q |
208 |
tcttgaatgaattgtcattgacgacttgtataacaattatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3642199 |
tcttgaatgaattgtcattgacgacttgtataacaattatg |
3642159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 9806864 - 9806801
Alignment:
| Q |
8 |
tgaaatgaagctgctaactttatgatcgtctcaagattcatttgttgtctcaaattttaaagta |
71 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9806864 |
tgaaatgaagctgttaaccttatgattatctcaagattcatttgttgtctcaaattataaagta |
9806801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 141 - 204
Target Start/End: Original strand, 10606872 - 10606935
Alignment:
| Q |
141 |
ttcagctgccttggttagtttattcgcatcaatatcctggtcatgttaactttggcactgatga |
204 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||| |||| | |||||| |||||||||||| |
|
|
| T |
10606872 |
ttcagctgccttgtttagtttattccaattaatatccaggtccttttaactctggcactgatga |
10606935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University