View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_288 (Length: 251)
Name: NF10829A_low_288
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_288 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 42821958 - 42822161
Alignment:
| Q |
1 |
cacggggcacctgctccattgcaacattcgcaatgaattgtgcactggttaatgctaataatggtcctggcctcaacaacattgcagccaaggttgaatc |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821958 |
cacggggcaccttctccacttcaacattctctatgaattgtgccctggttaatgctaataatggtcctggcctcaacaacattgcagccaaggttgaatc |
42822057 |
T |
|
| Q |
101 |
ctgatgcattatcatcaacatttctaattctatcattggtgatgaagtaataattataaatttatggtgcatttctaagatacgaaacaataaaatttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42822058 |
ctgatgcattatcatcaacatttctaattgtatcattggtgatgaagtaataattataaatttatggtgcatttgtaagatacgaaacaataaaatttgg |
42822157 |
T |
|
| Q |
201 |
cgta |
204 |
Q |
| |
|
|||| |
|
|
| T |
42822158 |
cgta |
42822161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University