View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10829A_low_308 (Length: 249)

Name: NF10829A_low_308
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10829A_low_308
NF10829A_low_308
[»] chr1 (1 HSPs)
chr1 (1-244)||(4082869-4083112)
[»] chr3 (1 HSPs)
chr3 (157-200)||(48203029-48203072)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 4082869 - 4083112
Alignment:
1 agacaaagaacatagaacaaattgtcagcaatagacatcacttacatagataatagcttttgtcatgggaagaagattgccctatgacaatgccaataat 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||    
4082869 agacaaagaacatagaacaaattgtcagcaatagaaatcacttacatcgataatatcttttgtcatgggaagaagattgccctatgacaatgccaacaat 4082968  T
101 tcattgataggtccatttctatatttttcattctccctaataggattagcaacaagcattgccataatcacaactctatgtagtgttcgatttcgaagaa 200  Q
    | ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4082969 ttattaataggtccatttctaaatttttcattctccctaataggattagcaacaagcattgccataatcacaactctatgtagtgttcgatttcgaagaa 4083068  T
201 gaaaattgacgccgccccctacaacaccgatatcaaacaccaaa 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
4083069 gaaaattgacgccgccccctacaacaccgatatcaaacaccaaa 4083112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 48203072 - 48203029
Alignment:
157 cattgccataatcacaactctatgtagtgttcgatttcgaagaa 200  Q
    ||||||||||||||||||| |||||||| ||||||| |||||||    
48203072 cattgccataatcacaactatatgtagttttcgattccgaagaa 48203029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University