View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_312 (Length: 249)
Name: NF10829A_low_312
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_312 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 42663815 - 42664055
Alignment:
| Q |
1 |
atctcacagcaagaatagtcaagaactattcgctannnnnnnnnatctattttgtctatccttcccttaatggataatactatctcnnnnnnnnnnggta |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| || |||| |
|
|
| T |
42663815 |
atctaacagcaagaatagtcaagaactattcgctatttttttt-atctattttgtctatctttcccttaatggataatactatttctttttttt--ggta |
42663911 |
T |
|
| Q |
101 |
caatatataatactatttcttactaatactaaatgcaagaaactaactagcagcttcgtgttttccgtgaaagactgaaattata-nnnnnnnngttata |
199 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42663912 |
caatggataatactatttcttacgaatactaaatgcaagaaactaactagcagctccgtgttttccgtgaaagactgaaattatatttttttttgttata |
42664011 |
T |
|
| Q |
200 |
taaaaaataattgtaatagccaatttctctctatcatgtgtttc |
243 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42664012 |
taaaaaataattgtaatagtcaatttctatctatcatgtgtttc |
42664055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University