View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_326 (Length: 247)
Name: NF10829A_low_326
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_326 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 33 - 232
Target Start/End: Original strand, 33104506 - 33104705
Alignment:
| Q |
33 |
ttgtttgcatatgcacaggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttac |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104506 |
ttgtttgcatatgcacaggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttac |
33104605 |
T |
|
| Q |
133 |
aggtcctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttgatgtcca |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33104606 |
aggtcctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttgatttcca |
33104705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 49 - 210
Target Start/End: Complemental strand, 10835967 - 10835806
Alignment:
| Q |
49 |
aggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttacaggtcctgcagtcatg |
148 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| ||||||||||| || || |||||||||||||| |||||| | |||| ||||| ||||| ||||| ||| |
|
|
| T |
10835967 |
aggtctgtttatggctcttcaacccaagatcattgcatgtgggaattctgttgcttcatttgccatggctataagattccttactggtccagcagttatg |
10835868 |
T |
|
| Q |
149 |
gctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggt |
210 |
Q |
| |
|
|| |||||||| || || ||||| || ||||| | ||| ||| |||||||||||||||||| |
|
|
| T |
10835867 |
gcagcagcttctatcgccgttggcctccgtgggaccctcctacatgtagctattgttcaggt |
10835806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University