View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_328 (Length: 247)
Name: NF10829A_low_328
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_328 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 46477900 - 46477687
Alignment:
| Q |
16 |
attactaataccccttcatcactacacgcttagcacgcacattatttgacaaatatataaaacaataaccacattatacagtaatatttcaatcaattaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46477900 |
attactaataccccttcatcactacacgcttagcacgcacattatttgacaaatatataaaacaataaccacattatacagtaatatttccatcaattaa |
46477801 |
T |
 |
| Q |
116 |
attaaaataatctaaattccactactatcacagctgtaacaagaatttggtcaaaatcccagaaacaaacaatactaattccatcacaaaggtatttctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46477800 |
attaaaataatctaaattccactactatcacagctgtaacaagaatttggtcaaaatcccagaaacaaacaatactaattccatcacaaaggtatttctc |
46477701 |
T |
 |
| Q |
216 |
cacatatgaacaca |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46477700 |
cacatatgaacaca |
46477687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University