View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_329 (Length: 247)
Name: NF10829A_low_329
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_329 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 28087068 - 28086852
Alignment:
| Q |
16 |
attttttccctttggcatatgctttttaatatttttgtccccaatcttaagattgaatccttcattactattaggatcgtcaaaggaatccaacatttta |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28087068 |
attttttccctttggcatttgctttttaatatttttgtccccaatctttagattgaatccttcattactattagggtcgtcaaaggaatccaacatttta |
28086969 |
T |
|
| Q |
116 |
gtaaggttgctaggttcctttgtttggccttttatagctgcagatgccagtgctggaggaggtggcaaacctgaattgtttatagcaggattagcttgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
28086968 |
gtaaggttgctaggttcctttgtttggccttttatagctgcagatgccagtgctggaggaggtggcaaacctgaattgctcatagcaggattagcttgct |
28086869 |
T |
|
| Q |
216 |
ccgcttgctttactgat |
232 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
28086868 |
ccccttgctttactgat |
28086852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 41043356 - 41043419
Alignment:
| Q |
17 |
ttttttccctttggcatatgctttttaatatttttgtccccaatcttaagattgaatccttcat |
80 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||| ||||||| || || |||||||||| |
|
|
| T |
41043356 |
ttttttccctttggcatttgctttttaatgttcttgtcaccaatctgaaaatcaaatccttcat |
41043419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University