View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_330 (Length: 247)
Name: NF10829A_low_330
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_330 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 30411019 - 30411230
Alignment:
| Q |
15 |
aacagtgctaatgatgatgaacaagcagtcctgcaacaagatatctagttcttaaaagagtcatggtccaaccttgttgagatggagccaatgatggtga |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30411019 |
aacagtgctaatgatgatgatcaagcagtcctgcaacaagatatctagttcttaaaagagtcatggtccaaccttgttgagatgaagccaatgatggtga |
30411118 |
T |
|
| Q |
115 |
ctttgaacaagatctcaatgctgtcaagtaacaggtcaggaggtaaatacagctagaaacttgattggtaagttacctgcagaaacatctttttccaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30411119 |
ctttgaacaagatctcaatgctgtcaa--tacaggtcaggaggcaaatacatctagaaacttgattggtaagttacctgcagaaacatctttgtccaaag |
30411216 |
T |
|
| Q |
215 |
aagcagatgctctt |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30411217 |
aagcagatgctctt |
30411230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University