View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_331 (Length: 246)
Name: NF10829A_low_331
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_331 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 7899279 - 7899486
Alignment:
| Q |
18 |
aatatagaagcttgaagacatgaattaagttgtgtggaacaatattctcgtcatttaacagaagcaaaattattccaaaaatctactttactgaatgctt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899279 |
aatatagaagcttgaacacatgaattaagttgtgtggaacaatattctcgtcatttaacagaagcaaaattattccaaaaatctactttactgaatgctt |
7899378 |
T |
 |
| Q |
118 |
gatttgtaagatagaagtgtcattgcactagatgtatgccaaaaactccttgcacattaaccaactgaagccatgtgtcggatcaagtcaaccacgcgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899379 |
gatttgtaagatagaagtgtcattgcactagatgtatgccaaaaactccttgcacattaaccaactgaagccatgtgtcggatcaagtcaaccacgcgtg |
7899478 |
T |
 |
| Q |
218 |
agctgtat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
7899479 |
agctgtat |
7899486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University