View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_337 (Length: 246)
Name: NF10829A_low_337
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_337 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 24301046 - 24301264
Alignment:
| Q |
16 |
tcaatttagacatatcatgttttatttccaaccctacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcatttgggcttcgaa |
115 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
24301046 |
tcaacttagacatatcatattttatttccaaccatacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcacttgggctttgaa |
24301145 |
T |
|
| Q |
116 |
gcccgcagtgtgggttcggatgagcatctgtttagagctattgatgagcttttttcaactcaacgaggaaacttttcttcaacattgatcagagtccact |
215 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| |||| ||| ||||||||| | || |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24301146 |
gcccgcagtgtgggttatgatgcgcacctgtttggagccatttatgagctttcatacgcttaacggagaaacttttcttcaacattgatcagagtccact |
24301245 |
T |
|
| Q |
216 |
ccaacacttccaacatatt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24301246 |
ccaacacttccaacatatt |
24301264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University