View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_341 (Length: 245)
Name: NF10829A_low_341
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_341 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 4 - 199
Target Start/End: Original strand, 45592680 - 45592875
Alignment:
| Q |
4 |
agcagagaacaagtaagagctttcaccatctaatgtttaattttcaaatttttagaaccttattacatcgagtcatgaatttgatgagcagagctcagag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45592680 |
agcagagaacaagtaagagctttcaccatctaatgtttaattttcaaatttttagaaccttattacatcgagtcatgaatttgatgagcagagctcagag |
45592779 |
T |
|
| Q |
104 |
aagactttcaaccataacagcatgggagaacagtaagaaagctgctaaagaagctgaattgagaaaacttgaggtaagaacttattttatttatat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45592780 |
aagactttcaaccataacagcatgggagaacagtaagaaagctgctaaagaagctgaattgagaaaacttgaggtaagaacttattttatttatat |
45592875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University