View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_344 (Length: 244)
Name: NF10829A_low_344
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_344 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 38359303 - 38359526
Alignment:
| Q |
20 |
atatcatgcaatcagatttacaatgggatcaattcattagaagcaggatcctaaggaacnnnnnnnccagtcgattatcatgtttcttcatctgttttga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
38359303 |
atatcatgcaatcagatttacaatgggatcagttcattagaagcaggatcctaaggaacaaaaaa-ccagtcaattatcatgtttcgtcatctgttttga |
38359401 |
T |
|
| Q |
120 |
ttggtgctaggcataaatactctactgtgctagaaaatgtgtcttgaaatattcgaaatggggaaaatattaacttctggattgattcctggtgtagaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38359402 |
gtggtgctaggcataaatactctactgtgctagaaaatgtgtcttgaaatattggaaatggggaaaatattaacttctggattgattcctggtgtagaga |
38359501 |
T |
|
| Q |
220 |
gcctttgacaattgcacttaacatt |
244 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
38359502 |
gcctttgacaactgcacttaacatt |
38359526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University