View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_346 (Length: 243)
Name: NF10829A_low_346
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_346 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 38932242 - 38932026
Alignment:
| Q |
6 |
aggttcgttatgtgaaacagggtgaccttattgctattccacctggtgttccttactggacctacaattacggcaataccccgcttattattgtcactct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38932242 |
aggttcgttatgtgaaacagggtgaccttattgctattccacctggtgttccttactggacctacaattacggcaatacccctcttattattgtcactct |
38932143 |
T |
 |
| Q |
106 |
cctcgacacttccaataaactaaaccaactcgatcgtatcccaagagtaagcaacattaattataatctaacaattactcctaaatgcaaccaactttgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932142 |
cctcgacacttccaataaactaaaccaactcgatcgtatcccaagagtaagcaacattaattataatctaacaattactcctaaatgcaaccaactttgt |
38932043 |
T |
 |
| Q |
206 |
tatatataaatgattca |
222 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
38932042 |
tatatataaatcattca |
38932026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University