View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_354 (Length: 242)
Name: NF10829A_low_354
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_354 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 8683394 - 8683503
Alignment:
| Q |
133 |
cagaatcaaggactcagagaaagtgacttcagatcacgttggttagctaggaatcaaaggattcttgattcattgctttctgaatcgtcttccattatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683394 |
cagaatcaaggactcagagaaagtgacttcagatcacgttggttagctaggaatcaaaggattcttgattcattgctttctgaatcgtcttccattatgt |
8683493 |
T |
|
| Q |
233 |
gcctacaggt |
242 |
Q |
| |
|
|| ||||||| |
|
|
| T |
8683494 |
gcttacaggt |
8683503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University