View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_356 (Length: 241)
Name: NF10829A_low_356
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_356 |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0328 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 219
Target Start/End: Complemental strand, 13464 - 13270
Alignment:
| Q |
25 |
atggtgttttatatctcttgatttgaaagtaaagtgggttgcttgctgctatttatgtcccttgaattttaaaacaggtgcatcatgtgtagagctgagg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
13464 |
atggtgttttatatctcttgatttgaaagtagagtgggtttcttgctgctatttatttcccttgtatttgaaaacaggtgcatcatgtgtagagctgagg |
13365 |
T |
 |
| Q |
125 |
cacaccagctttattccagaaaacccatatttgattcacttggttttcaactatttgctgttcttcatgaggaaattgaatcagaggtaattaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13364 |
cacaccagctttattccagaaaacccatatttgattcacttggttttcaactatttgcagttcttcatgaggaaattgaatcagaggtaattaat |
13270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 96 - 213
Target Start/End: Complemental strand, 27336929 - 27336812
Alignment:
| Q |
96 |
aaacaggtgcatcatgtgtagagctgaggcacaccagctttattccagaaaacccatatttgattcacttggttttcaactatttgctgttcttcatgag |
195 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||| | ||||| ||||||||||||||| ||||||| |||||||||||| |||| |||||||| |
|
|
| T |
27336929 |
aaacaggtgcatcatgtgcagagcagaggcacacaagctcttctccaggaaacccatatttgatgcacttggggttcaactatttgttgttgttcatgag |
27336830 |
T |
 |
| Q |
196 |
gaaattgaatcagaggta |
213 |
Q |
| |
|
| || || ||||||||| |
|
|
| T |
27336829 |
cacatagagtcagaggta |
27336812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 96 - 213
Target Start/End: Original strand, 29176842 - 29176959
Alignment:
| Q |
96 |
aaacaggtgcatcatgtgtagagctgaggcacaccagctttattccagaaaacccatatttgattcacttggttttcaactatttgctgttcttcatgag |
195 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||| | ||||| ||||||||||||||| ||||||| |||||||||||| |||| |||||||| |
|
|
| T |
29176842 |
aaacaggtgcatcatgtgcagagcagaggcacacaagctcttctccaggaaacccatatttgatgcacttggggttcaactatttgttgttgttcatgag |
29176941 |
T |
 |
| Q |
196 |
gaaattgaatcagaggta |
213 |
Q |
| |
|
| || || ||||||||| |
|
|
| T |
29176942 |
cacatagagtcagaggta |
29176959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University