View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_360 (Length: 241)
Name: NF10829A_low_360
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_360 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 22837787 - 22837942
Alignment:
| Q |
17 |
agcagagaatggaagttcttggaaagttaagacactccaacattgttagcttaaaggcttattattttgcaagggatgaaaaattgcttgtctttgatta |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837787 |
agcagagaatggaaattcttggaaagttaaaacactccaacattgttagcttaaaggcttattattttgcaagggatgaaaaattgcttgtctttgatta |
22837886 |
T |
 |
| Q |
117 |
catggttaatggtagcttgttttggcttcttcatggtatgatttcttttctttctc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837887 |
catggttaatggtagcttgttttggcttcttcatggtatgatttcttttctttctc |
22837942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University