View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_363 (Length: 241)
Name: NF10829A_low_363
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_363 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 30841800 - 30841577
Alignment:
| Q |
18 |
aataacccctagtacgaggaaataaagaaatggaccaaccacannnnnnnataattaatgttgtttagcaaatatgaggtagaagttttacattgtttta |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30841800 |
aataaccgctagtacgaggaaataaagaaatggaccaaccacatttttttataattaatgttgtttagcaaatatgaggtagaagttttacattgtttaa |
30841701 |
T |
 |
| Q |
118 |
aaagtgaaggttccgattttgagtaaagatggggtgtacaattcacttgtatgatcgctcttagtctaatgaggatgatccatcgggctcctctcgtaac |
217 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
30841700 |
aaagtggaggttacgattttgagtaaagatggggtgtacaattcacttgtatgatcgctctgagtccaatgtggatgatccatcgggctcctctcgtaac |
30841601 |
T |
 |
| Q |
218 |
ccaacaatggcctctgtgacgtgg |
241 |
Q |
| |
|
||||| ||| ||||||||||||| |
|
|
| T |
30841600 |
gcaacagtggtctctgtgacgtgg |
30841577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University