View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_367 (Length: 240)
Name: NF10829A_low_367
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_367 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 80 - 217
Target Start/End: Complemental strand, 10274788 - 10274651
Alignment:
| Q |
80 |
aagaaattgtaaatgaacggttaagtttggatgacacattttgcttatgtaagccaaagtttatttccacttcattagtctttggctttttatgaacttt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274788 |
aagaaattgtaaatgaacggttaagtttggatgacacattttgcttatgtaagccaaagtttatttccacttcattagtctttggctttttatgaacttt |
10274689 |
T |
|
| Q |
180 |
tctttatctaacttcattttatcattgccctatttcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10274688 |
tctttatctaacttcattttatcattaccctatttcat |
10274651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 148 - 217
Target Start/End: Complemental strand, 10266805 - 10266736
Alignment:
| Q |
148 |
acttcattagtctttggctttttatgaacttttctttatctaacttcattttatcattgccctatttcat |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |||||||| || ||| ||||||| |
|
|
| T |
10266805 |
acttcattagtctttggctttttctgaacatttctttatctaactttattttatcgttaccccatttcat |
10266736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University