View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_368 (Length: 240)
Name: NF10829A_low_368
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_368 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 42 - 232
Target Start/End: Original strand, 31799212 - 31799402
Alignment:
| Q |
42 |
tagtatcattttcaaccgcttatttgcacattcatgagactcttcttcttttaaaaatgtcacctctactctatctatattagtggcatttcgagccatc |
141 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799212 |
tagtatcattttcaaccacttatttgcacattcatgagactcttcttcttttaaaaatgtcacctctactctatctatattagtggcatttcgagccatc |
31799311 |
T |
|
| Q |
142 |
ccttcccatactaataagcggacttttggttcttttgcttgcatgcttgaaattcatctctcatataacatgtctggtttcaatattcttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31799312 |
ccttcccatactaataagcggacttttggttcttttgcttgcatgcttgaaattcatctctcatataacatgtctggtttcaattttcttc |
31799402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University