View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_369 (Length: 240)
Name: NF10829A_low_369
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_369 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 45929717 - 45929488
Alignment:
| Q |
5 |
aagaaacaaagagtagaaaactgcttgctcaaaaagataggacaattttttatctcacagcagaaggacaagagcactattatgagtgaagcattggcat |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45929717 |
aagaaataaagagtagaaaactgcttgctcaaaaagataggactattttttatctcacagcagaaggacaagagcactattatgagtgaagcattggcat |
45929618 |
T |
|
| Q |
105 |
aaaataaatacatatcatatcaccaattcagacaagtgtgttttcaatgacctaacctcaaacataagatcgtactttccatcccggtttctcattctca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45929617 |
aaaataaatacatatcatatcaccaattcagacaagtgtgttttcaatgacctaacctcaaacataagattgtactttccatcccggtttctcattctca |
45929518 |
T |
|
| Q |
205 |
aatatgattgacatgcttcagggtcttctc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45929517 |
aatatgattgacatgcttcagggtcttctc |
45929488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University