View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_378 (Length: 238)
Name: NF10829A_low_378
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_378 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 36 - 214
Target Start/End: Original strand, 40866236 - 40866414
Alignment:
| Q |
36 |
atagaaaagatcatcaaagtgcagaagggcctaactctttcaattacttgtgtgccaagccatgtacttcatattttcaattcagtacaactcaaaattt |
135 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866236 |
atagataagatcatcaaagtgcagaagggcctaactcttccaattacttgtgtgccaagccatgtacttcatattttcaattcagtacaactcaaaattt |
40866335 |
T |
|
| Q |
136 |
gatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggctaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866336 |
gatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggctaat |
40866414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University