View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_394 (Length: 235)
Name: NF10829A_low_394
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_394 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 15827563 - 15827796
Alignment:
| Q |
1 |
atttcttatgatataaccaacattgtgtattttgatggacatgaaannnnnnncattgtgacctattgtattctcaaccccatagaaatcgtaataaaat |
100 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15827563 |
atttctcatgatataaccaacattttgtattttgatggacatgaaatttgtttcattgtgacctattgtattctcaaccccatagaaatcgtaataaaat |
15827662 |
T |
|
| Q |
101 |
ttgtggctaaaaaggtcttgctttcaaatagttaaaatagcaatccataactaggagtga--nnnnnnnncaactaacaactaagttataatgaaaacag |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15827663 |
ttgtggctgaaaaggtcttgctttcaaatagttaaaatagcaatccataactaggagtgatttttttttccaactaacaactaagttataatgaaaacag |
15827762 |
T |
|
| Q |
199 |
caaacaaaacacaatataaacagaacaccaaact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
15827763 |
caaacaaaacacaatataaacagaacacaaaact |
15827796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University