View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_397 (Length: 234)
Name: NF10829A_low_397
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_397 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 11685949 - 11685852
Alignment:
| Q |
115 |
gaagacttgctgtgaatgtggaaaagagcttaagtcatgccccatctgcagaagctgcattaacactagaattaagctttactaaggttattgttgtt |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11685949 |
gaagacttgttgtgaatgtggaaaagagcttaagtcatgccccatctgcagaagctgcattaacactagaattaagctttactaaggttattgttgtt |
11685852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 11686015 - 11685971
Alignment:
| Q |
50 |
aaattgttcaaaatacatcaaatatatgaggtatgttatttgata |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11686015 |
aaattgctcaaaatacatcaaatatatgaggtatgttatttgata |
11685971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University