View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_402 (Length: 232)
Name: NF10829A_low_402
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_402 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 3272182 - 3272416
Alignment:
| Q |
1 |
gttcgatttctagtaaaaataattattggtcagactttatttaccttctaaccgaaccggattgctagggcctctttccctaaaaaccggagggttaaca |
100 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3272182 |
gttcgattcctagtagaaataattattggtcagactttatttaccttctaaccgaaccggattgctagggcctcttcccctaaaaaccggagggttaaca |
3272281 |
T |
 |
| Q |
101 |
caaannnnnnnnnnnn---gacaaacagtgtggtttcatgttttttacatcatataacagcaatttcacaagcaatgtggttagatagattgttcaaaag |
197 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272282 |
caattttttttttttttttgacaaacagtgtggtttcatgttttttacatcatataacagcaatttcacaagcaatgtggttagatagattgttcaaaag |
3272381 |
T |
 |
| Q |
198 |
aaagcattttctttgaagggagttttacattctgt |
232 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3272382 |
aaaccattttctttgaagggagttttacattctgt |
3272416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University