View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_415 (Length: 230)
Name: NF10829A_low_415
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_415 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 2 - 224
Target Start/End: Complemental strand, 4082858 - 4082634
Alignment:
| Q |
2 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattcaaattcctatagaaatatatatg--gttttgggaaatgatcaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4082858 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatagaaatatatatatagttttgggaaatgatcaaatg |
4082759 |
T |
 |
| Q |
100 |
gaaannnnnnnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082758 |
gaaattttgttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
4082659 |
T |
 |
| Q |
200 |
taaacttggaaaatttagttgatag |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4082658 |
taaacttggaaaatttagttgatag |
4082634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University