View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_425 (Length: 230)
Name: NF10829A_low_425
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_425 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 4 - 92
Target Start/End: Original strand, 9611824 - 9611909
Alignment:
| Q |
4 |
ttccatcttttgtaatttgatgatggtataaaataatattgaccaacccaatcatttcactttgttttggaagaaatataaaataatga |
92 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
9611824 |
ttccatcttttgtaatttgat---ggtataaaataatattgaccaacccaatcatttcacttggttttggaagaactataaaataatga |
9611909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 21237473 - 21237439
Alignment:
| Q |
177 |
tcatgtattacttatattaaaccctactagcgaag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21237473 |
tcatgtattacttatattaaaccctactaacgaag |
21237439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University