View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10829A_low_427 (Length: 230)

Name: NF10829A_low_427
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10829A_low_427
NF10829A_low_427
[»] chr3 (1 HSPs)
chr3 (1-107)||(34142474-34142580)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 34142474 - 34142580
Alignment:
1 gcagtttcaaagtgacttttaatatcttgattaatctctcccttgataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34142474 gcagtttcaaagtgacttttaatatcttgattaatctctcccttaataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaa 34142573  T
101 tccagta 107  Q
    |||||||    
34142574 tccagta 34142580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University