View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_431 (Length: 230)
Name: NF10829A_low_431
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_431 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 38217860 - 38217641
Alignment:
| Q |
7 |
gctcttatcatataatgttatttttaccttatattaatcggaatatctcaaataaataatccttaagtattcacaaaattggagatgaatgagttgactg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38217860 |
gctcttatcatataatgttatttttaccttatattaatcggaatatctcaaataaataatccttaagtattcacaaaattggagatgaatgagttgac-- |
38217763 |
T |
|
| Q |
107 |
acattcacatgtaattaaggacaattttcaaagtgagacacttcttaacacatttgtggggccttcatagtgtaagaacttaaaattgtgttgatattct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
38217762 |
--attcacatgtaattaaggacaattttcaaagtgagacacttcttaacacatttgtggggccttcatagtgtaagtacttaacattgtgttgatattct |
38217665 |
T |
|
| Q |
207 |
taaattctatgtggcaattgtgga |
230 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
38217664 |
taaactctatgtggcaattgtgga |
38217641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University