View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_433 (Length: 230)
Name: NF10829A_low_433
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_433 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 33026416 - 33026193
Alignment:
| Q |
7 |
ttcttaccttcggtgtgtcaatctcgaacacaggtctcttctgattcacaatcttttgattctcaaactgtttttgcatgacagatggaaatgttcttga |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33026416 |
ttcttaacttcggtgtgtcaatctcgaacacaggtctcttctgattcacaatcttttgattctcagactgtttttgcatgacagatggaaatgttcttga |
33026317 |
T |
|
| Q |
107 |
aggggattgttctaatcccatcaactttgcaacaagattggtacttttttccttccttggaaaagtcggtgaacacgaagaatcagaaagtttgtcatac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026316 |
aggggattgttctaatcccatcaactttgcaacaagattggtacttttttccttccttggaaaagtcggtgaacacgaagaatcagaaagtttgtcatac |
33026217 |
T |
|
| Q |
207 |
caaacaacagatgattggcttgag |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33026216 |
caaacaacagatgattggcttgag |
33026193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University