View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_454 (Length: 229)
Name: NF10829A_low_454
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_454 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 45 - 224
Target Start/End: Original strand, 32687257 - 32687438
Alignment:
| Q |
45 |
acggattaaacaatgattcaaagatctcatcgattctatct--ggtctaattttttaaatattcgagaaaccgaaacctgtannnnnnnaaattgaacca |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
32687257 |
acggattaaacaatgattcaaagatctcatcgattctatctttggtctaattttttaaatatttgagaaaccgaaacctgtattttttaaaattgaacca |
32687356 |
T |
|
| Q |
143 |
attaaaaatagcatgtttggtttttatgatgnnnnnnncatgaagttttaaccaaattggatcgatgaagaaccaattattt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32687357 |
attaaaaatagcatgtttggtttttatgatgtttttttcataaaattttaaccaaattggatcgatgaagaaccaattattt |
32687438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University