View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_455 (Length: 229)
Name: NF10829A_low_455
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_455 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 3592415 - 3592183
Alignment:
| Q |
1 |
tcatgacattagtatccataaacttttggataactgttgcttagattgtttg----atcttcttgatcttgaacaatgcagattgacagtgttcatgaag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592415 |
tcatgacattagtatccataaacttttggataactgttgcttagattgtttggtcgatcttcttgatcttgaacaatgcagattgacagtgttcatgaag |
3592316 |
T |
|
| Q |
97 |
atggtgcagtggtttttaaagatggaaatgcagttattgctgacttcattgtacattgcacagggtattcttagcattccctattagtttttcttttaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592315 |
atggtgcagtggtttttaaagatggaaatgcagttatcgctgacttcattgtacattgcacagggtattcttagcattccctattagtttttcttttaaa |
3592216 |
T |
|
| Q |
197 |
ccagtttatattgtggacttaagttttaaatcg |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
3592215 |
ccagttcatattgtggacttaagttttaaatcg |
3592183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University