View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_462 (Length: 228)
Name: NF10829A_low_462
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_462 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 10576193 - 10575966
Alignment:
| Q |
1 |
tataatggtgcatatgcaattcattggccaccaggagatgctaatgtttttctatccttgtgaataaatgcaaaatttatgatgaagatagcatggcaag |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576193 |
tataatggtgtatatgcaattcattggccaccaggagatgctaatgtttttctatccttgtgaataaatgcaaaatttatgatgaagatagcatggcaag |
10576094 |
T |
|
| Q |
101 |
agctacccactataaaaatgtgggtcttcgttaggacaagacgttctgattaacataatttatggtgattatgttaatcacagatgcaatattcaacaca |
200 |
Q |
| |
|
|||||| |||||||| ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10576093 |
agctactcactataagaatgtgggtcttctttgggacaagaagttctgattaacataatttatggtgattatgttaatcacagatgcaatattgaacaca |
10575994 |
T |
|
| Q |
201 |
gaacttaatagcttacaatagttcatga |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
10575993 |
gaacttaatagcgtacaatagttcatga |
10575966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University