View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_463 (Length: 228)
Name: NF10829A_low_463
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_463 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 25014511 - 25014292
Alignment:
| Q |
2 |
ttcactctacttgtcaagatctgctagcattgtgatgttggctgcatattttgcgtacttgatctttcaactatggacacacaggcaattattcgaagct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25014511 |
ttcactctacttgtcaagatctgctagcattgtgatgttggctgcatattttgcttacttgatctttcaactatggacacacaggcaattatttgaagct |
25014412 |
T |
|
| Q |
102 |
gaagatgtatgttttcttaattaaaccatatatgaaaatgatggatcattgatttgcaattttaatttttattataagtgtttataacatgattcattga |
201 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25014411 |
gaagatgtatgctttcgtaattaaaccatatatgaaaatgatgaatcattgatttgcaattttaatttttattataagtgtttataacatgattcattga |
25014312 |
T |
|
| Q |
202 |
tgaacaggaaggtgaaggtg |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25014311 |
tgaacaggaaggtgaaggtg |
25014292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 116
Target Start/End: Original strand, 5130259 - 5130351
Alignment:
| Q |
24 |
gctagcattgtgatgttggctgcatattttgcgtacttgatctttcaactatggacacacaggcaattattcgaagctgaagatgtatgtttt |
116 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||| | |||| ||||||||||| ||| | |||||||| ||||| |||||||||||||| |
|
|
| T |
5130259 |
gctagcattgtgatggtgattgcatattttgcataccttttcttccaactatggactcaccgacaattatttgaagcacaagatgtatgtttt |
5130351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University