View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_465 (Length: 227)
Name: NF10829A_low_465
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_465 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 101 - 219
Target Start/End: Complemental strand, 41760655 - 41760537
Alignment:
| Q |
101 |
attagaatgtaatcaatttccgacaatttatctccctcgtcatcatgtgcatcaaatagttcaacttcttctccttgttcttcgtctatgaaaattatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760655 |
attagaatgtaatcaatttccgacaatttatctccctcatcatcatgtgcatcaaatagttcaacttcttctccttgttcttcgtctatgaaaattatat |
41760556 |
T |
|
| Q |
201 |
tttcaatatattcttcgac |
219 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
41760555 |
tttcaatattttcttcgac |
41760537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 101 - 172
Target Start/End: Complemental strand, 41795456 - 41795385
Alignment:
| Q |
101 |
attagaatgtaatcaatttccgacaatttatctccctcgtcatcatgtgcatcaaatagttcaacttcttct |
172 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
41795456 |
attagaatgtaatcaatttccgaccctttatctccgtcttcatcatctgcatcaaatagttcaacttcttct |
41795385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University