View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_476 (Length: 226)
Name: NF10829A_low_476
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_476 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 28250100 - 28250309
Alignment:
| Q |
1 |
gaatgacatcacgaggaggtcgtcgacggtaacgtgttcgcggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250100 |
gaatgacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtgg |
28250199 |
T |
|
| Q |
101 |
atggcgcaacggaggaggcagcaaagggagttgattggaaaagctgctttctctgaagggaagagattgataattaactgtagaaggcttcgttgttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28250200 |
atggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagagattgataattaactctagaaggcttcgttgttttg |
28250299 |
T |
|
| Q |
201 |
atctgatgtc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
28250300 |
atctgatgtc |
28250309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University