View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_480 (Length: 225)
Name: NF10829A_low_480
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_480 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 13245487 - 13245276
Alignment:
| Q |
1 |
ttgcagtattggaggaaaccaccaaaaaatttctgactgtcatttatccggtgtgtccttgatccttagaaggccgccaacattccttccttttcgacgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13245487 |
ttgcagtattggaggaaaccaccaaaaaaattctgaatgtcatttatccggtgtgtccttgatccttagaaggccgccaaaattccttccttttcgacgg |
13245388 |
T |
|
| Q |
101 |
ctttttggccttagcagcggctgatgacagccagaaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaagagtt |
200 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
13245387 |
ctttttggccttaccagcggcttatgacagccagaaatacagttatttcttgtagtgatggtcaccctgtgtcactaaagttttattttgcgcaagagtt |
13245288 |
T |
|
| Q |
201 |
tcatagcttata |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13245287 |
tcatagcttata |
13245276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 135 - 206
Target Start/End: Complemental strand, 13266638 - 13266567
Alignment:
| Q |
135 |
aaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaagagtttcatag |
206 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13266638 |
aaatatagttatttcttgtagtgatggtcactctgtgtcactaaagttttattttgcgtaagagtttcatag |
13266567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University