View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_483 (Length: 225)
Name: NF10829A_low_483
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_483 |
 | |
|
| [»] scaffold0035 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 24 - 208
Target Start/End: Complemental strand, 5832045 - 5831861
Alignment:
| Q |
24 |
aaggaagagttgctgataacgcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5832045 |
aaggaagagttgctgataattcaattgggccattagagattcgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
5831946 |
T |
|
| Q |
124 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcagttcat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831945 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcagttcat |
5831861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 24 - 191
Target Start/End: Original strand, 5823994 - 5824161
Alignment:
| Q |
24 |
aaggaagagttgctgataacgcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| || ||||| | ||||||||| |||||| ||||||| |
|
|
| T |
5823994 |
aaggaagagttgctgataattcaattgggccattagagattcgtgtggtgaaaaatggcacattcgaggatttgatggattattatatatcgtgtggtgc |
5824093 |
T |
|
| Q |
124 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactcta |
191 |
Q |
| |
|
| || ||||| |||||||||||||||||||||||| |||| ||| || |||||||||||||||||| |
|
|
| T |
5824094 |
atcgattaatcaatataaagttcctaggtgcgtgagtctcacacctgtagtggaacttcttgactcta |
5824161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 207
Target Start/End: Original strand, 78763 - 78938
Alignment:
| Q |
32 |
gttgctgataacgcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgcaagtatca |
131 |
Q |
| |
|
||||||||| | ||||||| ||||| ||||| | || ||||| | ||| || |||||||| || |||||||||||||| || | ||||| || | |
|
|
| T |
78763 |
gttgctgatcattcaattggaccattggagataagggttgtgaagagtggaacttttgaggagcttatggattatgcaatctcaagaggtgcttcaataa |
78862 |
T |
|
| Q |
132 |
atcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcagttca |
207 |
Q |
| |
|
|||| ||||||||||| ||||| || | ||| |||||||||||||| ||| | |||||||||||||| || ||||| |
|
|
| T |
78863 |
atcaatataaagttccaaggtgtgttaattttactcctataatggagcttttggactctagggtggtctctgttca |
78938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University