View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_487 (Length: 224)
Name: NF10829A_low_487
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_487 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 31439002 - 31438797
Alignment:
| Q |
1 |
tcaggtggtgataaaaggtgagtgatagtgagatccgtggcgctggcatggatgaaatctacgccagcgtcattgcatgtgataaagatgtgaccggcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31439002 |
tcaggtggtgataaaaggtgagtgatagtgagatccgtggcgctggcatggatgaaatctacgccagagtcattgcatgtgataaagatgtgaccggcag |
31438903 |
T |
|
| Q |
101 |
agtcggtcacaaaacggccagcaagtggggggaagattgatagggttttagagagagaggttttaaggtgggggatgagtgtttgagaagggagagatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31438902 |
agtcggtcacaaaacggccagcaagtggggggaagattgatagggttttagagagagaggttttaaggtgggggacgagtgtttgagaagggagagatgg |
31438803 |
T |
|
| Q |
201 |
tgatgt |
206 |
Q |
| |
|
||||| |
|
|
| T |
31438802 |
cgatgt |
31438797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University