View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_494 (Length: 221)
Name: NF10829A_low_494
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_494 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 9462211 - 9462349
Alignment:
| Q |
26 |
cagagagtagagtgaataattctgagatctcaaactaagatgattaacaactaatgaacttgaacaatt-----------------gtttattcatttaa |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
9462211 |
cagaaagtagagtgaataattctgagatctcaaactaagatgattaacaaataatcaacttgaacaattattaatgttgcttgcaggtttattcatttaa |
9462310 |
T |
|
| Q |
109 |
ttaaaactgtagcacctgatgcagaaaactatgcagaag |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462311 |
ttaaaactgtagcacctgatgcagaaaactatgcagaag |
9462349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 201
Target Start/End: Original strand, 9462363 - 9462391
Alignment:
| Q |
173 |
gctcgctaagcgatcatttctgttatgac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9462363 |
gctcgctaagcgatcatttctgttatgac |
9462391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University