View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_495 (Length: 221)
Name: NF10829A_low_495
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_495 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 14147856 - 14147955
Alignment:
| Q |
1 |
gggcttggggtcccaaatgatttcgccacactggacaatggtaagaaatatctctatcccccactctttgatatataactccctatagtctattatcaaa |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14147856 |
gggcttgggggcccaaatgatttcgccacactggacaatggtaagaaatatctctatcccccactctttgatatataactccctatagtctcttatcaaa |
14147955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 14147957 - 14148020
Alignment:
| Q |
159 |
caagtatacttgttttctactacaagaatatcaa-ttggtccatattttctaaaaaattgcaga |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
14147957 |
caagtatacttgttttccactacaagaatatcaacttgatccatattttctataaaattgcaga |
14148020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University