View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_496 (Length: 221)
Name: NF10829A_low_496
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_496 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 22 - 206
Target Start/End: Original strand, 54978146 - 54978333
Alignment:
| Q |
22 |
gacaccaccaactcctgataaccaaccaatggattcgccagaaagattcgac---aaccataagcgtagaaagttgagtaacggtttggacaagcatcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54978146 |
gacaccaccaactcctgataaccaaccaatggattcgccagaaagattcgactgcaaccataagcgtagaaagttgagtaacggtttggacaaccatcca |
54978245 |
T |
|
| Q |
119 |
catatggccggggcaaaaagttctagatgtgctatttggggttgtgactctgaattgatgcgtgatgaatgcggttttgatgttcttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54978246 |
catatggccggggcaaaaagttctagatgtgctatttggggttgtgactctgaattgatgcgtgatgaatgcggttttgatattcttc |
54978333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University