View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_499 (Length: 220)
Name: NF10829A_low_499
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_499 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 219
Target Start/End: Original strand, 41983035 - 41983248
Alignment:
| Q |
7 |
atgcttttctttattcaaatacaaaatgattgctatgaggtgcttctctctctgcatgtaactaagatagaagataacatggacagatgtttggatcctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983035 |
atgcttttctttattcaaatacaaaatgattgctatgaggtgcttctctctctgcatgtaactaagatagaagataacatggacagatgtttggatcctc |
41983134 |
T |
|
| Q |
107 |
tacggccctactaaggctccaaggaaatctcagacgaaggattgatctgac-ggtttcgagatcaaaatttgattggttagattaatccaataagcgata |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41983135 |
tacggccctactaaggctccaacaaaatctcagacgaaggattgatctgacgggtttcgagatcaaaatttgattggttagattaatccaataagcgaga |
41983234 |
T |
|
| Q |
206 |
ttaggcagaaaaag |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41983235 |
ttaggcagaaaaag |
41983248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University