View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_521 (Length: 215)
Name: NF10829A_low_521
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_521 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 27 - 199
Target Start/End: Complemental strand, 9897997 - 9897825
Alignment:
| Q |
27 |
atattcaaaaatggctaggctataatagggatgtaatacaaacaattgacttgtcatcagggctagccaccccagtgtaatttagtcgtgctggtaaata |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9897997 |
atattcaaaaatggctaggctataatagggatgtaatacaaacaattgacttgtcatcagggctagccaccccagtgcaatggagtcgtgctggtaaata |
9897898 |
T |
 |
| Q |
127 |
tctacattgtcttagatccaaaccaaggtgcaggggaagctaaaccttgttcggtcatgcttcataatgatgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9897897 |
tctacattgtcttagatccaaaccaaggggcaggggaagctaaaccttgttcggtcatgcttcataatgatgt |
9897825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University