View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_525 (Length: 214)
Name: NF10829A_low_525
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_525 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 23333847 - 23333649
Alignment:
| Q |
16 |
ggacatcacgaagtagaccgataaaattgtgtgccagaatgcagctgaagcagtactcccccaaagaggttgataagtttgttttatgtaattttttgct |
115 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333847 |
ggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtactccccccaagaggttgataagtttgttttatgtaattttttgct |
23333748 |
T |
 |
| Q |
116 |
gttttgatatattgtgtcatgttttaccaggaaaaatgtacacattgtcgttacctcaggaactgttgttcgtgttgctgatgagctttcccttcaaga |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333747 |
gttttgatatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttgcctcaggaactgttgttcgtgttgctgatgagctttcccttcaaga |
23333649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University