View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_527 (Length: 213)
Name: NF10829A_low_527
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_527 |
 |  |
|
| [»] scaffold0009 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 168; Significance: 3e-90; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 40181 - 40010
Alignment:
| Q |
21 |
atcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcacacacgaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181 |
atcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcacacacgaaa |
40082 |
T |
 |
| Q |
121 |
atggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40081 |
atggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgtcgttttgctgcttca |
40010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 70 - 190
Target Start/End: Complemental strand, 33511 - 33391
Alignment:
| Q |
70 |
ggtacatttaatctatccaatttgaggaccacaagtgtttcacacacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaa |
169 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||| || ||||||||||||||||||||| | |
|
|
| T |
33511 |
ggtacaattattctatccaatttgagaaccacaagtgtttcacacacgaaaatggtaggcgacaaggtcacttctaccatgcatagatagagatcctcga |
33412 |
T |
 |
| Q |
170 |
caccgcgttgttttgctgctt |
190 |
Q |
| |
|
| || ||| |||||||||||| |
|
|
| T |
33411 |
ccccacgtcgttttgctgctt |
33391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 191
Target Start/End: Complemental strand, 21826 - 21734
Alignment:
| Q |
99 |
cacaagtgtttcacacacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttc |
191 |
Q |
| |
|
|||||||||| ||| |||||||||||||| ||||| |||||| ||||| | ||||||||||||||| || || ||| |||||||| |||| |
|
|
| T |
21826 |
cacaagtgttctacaaacgaaaatggtaggcgacaaggtcacttctaacaagtttagatagagatcctcgaccccacgtcgttttgcttcttc |
21734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 128
Target Start/End: Original strand, 19970209 - 19970313
Alignment:
| Q |
24 |
aagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcacacacgaaaatg |
123 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| | ||| |||||| | ||||| || ||| |||||| || ||||||||||||||||| ||||||| |
|
|
| T |
19970209 |
aagggttttgagcgaaggaagatcaacagaagaacgaaacatagttgttacatgtatgctaaacaatttcagaaccacaagtgtttcacagcagaaaatg |
19970308 |
T |
 |
| Q |
124 |
gtagg |
128 |
Q |
| |
|
||||| |
|
|
| T |
19970309 |
gtagg |
19970313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University