View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_53 (Length: 421)
Name: NF10829A_low_53
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 13 - 323
Target Start/End: Original strand, 45481347 - 45481657
Alignment:
| Q |
13 |
aatatgtgctggtatgagtcttggtcttaggatggttcaacttcttacagcaacgttggctcatgcatatgattgggagttggagaatggtgtaagtcca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45481347 |
aatatgtgctggtatgagtcttggtcttaggatggttcaacttcttacagcaacgttggctcatgcatatgattgggagttggagaatggtgtaagtcca |
45481446 |
T |
|
| Q |
113 |
gaaaagcttaatatggatgaagcatatgggctcaccttacagagagcagtgcctattttagcccatcctcgtccaaggctttcaccacatttgtacttgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45481447 |
gaaaagcttaatatggatgaagcatatgggctcaccttacagagagcagtgcctattttagcccatcctcgtccaaggctttcacctcatttgtacttgt |
45481546 |
T |
|
| Q |
213 |
aatcatcatcttttcgagtttggcttaatgccccttgtcttcatccaatcatcattctattattaaaattgtggatactctcaactttttaataaagcaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45481547 |
aatcatcatcttttcgagtttggcttaatgccccttgccttcatccaatcatcgttctattattaaaattgtggatactctcaactttttaataaagcaa |
45481646 |
T |
|
| Q |
313 |
gaaaagtttac |
323 |
Q |
| |
|
||||||||||| |
|
|
| T |
45481647 |
gaaaagtttac |
45481657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 45481653 - 45481709
Alignment:
| Q |
361 |
tttacattacattcaagtttgcttgtaaactatgaatgggccatagaggacattttg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45481653 |
tttacattacattcaagtttgcttgtaaactattaatgggccatagaggacattttg |
45481709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University