View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_530 (Length: 213)
Name: NF10829A_low_530
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_530 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 43713473 - 43713292
Alignment:
| Q |
12 |
tggacatcaaagataaaacttctgactactttcatatagaggctctgacacaatgtctagaactacctctagaagcacaagttattattacattgacgct |
111 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43713473 |
tggacatcaaagatcaaactcctgactactttcttatagaggctctgatacaatgtctagaactacctctagaagcacaagttattattacattgacgct |
43713374 |
T |
|
| Q |
112 |
cttaatgctttcgatgtcacttaagtacagtagaaaactgcaaaatgtgctagatgccacaacattttgatgtttaacctct |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43713373 |
cttaatgcttttgatgtcacttaagtacagtagaaaactgcaaaatgtgctagatgccacaacattttgatgtttaacctct |
43713292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University