View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_533 (Length: 212)
Name: NF10829A_low_533
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_533 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 35094334 - 35094531
Alignment:
| Q |
15 |
tgtttcagagacaatcggtattgattattcaactgttattttggtagcaatatttccatatttccatgtctgctagttactgttaataattttcaatgtc |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094334 |
tgtttcacagacaatcggtattgattattcaactgttattttggtagcaatatttccacatttccatgtctgctagttactgttaataattttcaatgtc |
35094433 |
T |
 |
| Q |
115 |
atacattggaagttgcatatgtttatacccacgaataatgacaatatcttcagaaagtggatggcatgatagttcatgttttcacttaattattggat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094434 |
atacattggaagttgcatatgtttatacccacaaataatgacaatatcttcagaaagtggatggcatgatagttcatgttttcacttaattattggat |
35094531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University