View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_534 (Length: 212)
Name: NF10829A_low_534
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_534 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 6358429 - 6358263
Alignment:
| Q |
20 |
atgtgtaaatccccataagcttaaccttgtgagtggtctgtaatccccatatcattatcaactaatttatgttttgaagcataaacctttggnnnnnnnn |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358429 |
atgtgtaaatccccataagcttaaccttgtgagtggtctgtaatccccatatcattatcaactaatttatgttttgaagcataaacctttgg-aaaaaaa |
6358331 |
T |
|
| Q |
120 |
tctgcaatctctttaatattgatttctgtcgctccttaatgtctcaagttcgattctccttaatgtct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
6358330 |
tctgcaatctctttaatattgatttctgttgctcctcaatgtctcaagttcgattctcctcaatgtct |
6358263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University