View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_536 (Length: 212)
Name: NF10829A_low_536
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_536 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 43098816 - 43098991
Alignment:
| Q |
20 |
aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagcagcttgcaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43098816 |
aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagctgcttgcaaa |
43098915 |
T |
 |
| Q |
120 |
atgcaaaatcatatagtactactgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattag |
195 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098916 |
atgcaaaatcatatagtactaccgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattag |
43098991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University